View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_low_93 (Length: 236)
Name: NF17260_low_93
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_low_93 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 23 - 236
Target Start/End: Complemental strand, 35520317 - 35520103
Alignment:
| Q |
23 |
caattaaaaaatattaaatttggaaaatggtcgcctaattagagagg-acacttcattgttagtaaggttcatagtgaaagaacctattatcggctccat |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35520317 |
caattaaaaaatattaaatttggaaaatggtcgcctaattagagagggacacttcattgttagtaaggttcatagtgaaagaacctattatcggctccat |
35520218 |
T |
|
| Q |
122 |
tcatgtttttgaaaatactagtagccacaaggctaactaacctgattgattaaaatataatacataaaaatcttacgaatgttgatcttgagcagattgg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35520217 |
tcatgtttttgaaaatactagtagccacaaggctaactaacctgattgattaaaatataagacataaaaatcttacgaatgttgatcttgagcagattgg |
35520118 |
T |
|
| Q |
222 |
tcaccatcaatagtc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35520117 |
tcaccatcaatagtc |
35520103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University