View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17261_high_14 (Length: 251)
Name: NF17261_high_14
Description: NF17261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17261_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 11 - 139
Target Start/End: Original strand, 587352 - 587480
Alignment:
| Q |
11 |
agaatattgtccgcttgcggtatatggttgaatacaattaggattaatcaaagagagaacttttttgaagcaaatttgcagaattggattgacttaaata |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
587352 |
agaatgttgtccgcttgcggtatatggttgaatacaattaggattaatcaaagagagaacttttttgaagcaaatttgcagaattggattgacttaaata |
587451 |
T |
 |
| Q |
111 |
tgaacatggagttgggcatgaatgataca |
139 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
587452 |
tgaacatggagttgggcatgaatgataca |
587480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 146 - 236
Target Start/End: Original strand, 587517 - 587607
Alignment:
| Q |
146 |
tgtcatgccttgtggtcttggagaaacagttgagtcatgatagtgaagctacaatgcctcttaactcttggaacaaggagggttaattgtt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
587517 |
tgtcatgccttgtggtcttggagaaacagttgagtcatcatagtgaagctacaatgcctcttaactcttggaacaaggagggttaattgtt |
587607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 33 - 120
Target Start/End: Complemental strand, 32058052 - 32057965
Alignment:
| Q |
33 |
tatggttgaatacaattaggattaatcaaagagagaacttttttgaagcaaatttgcagaattggattgacttaaatatgaacatgga |
120 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||| |||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
32058052 |
tatggttgaatacagttattattaatcaaagagagaacttttttgaagcagatttgcagcattggattggcttaaatatgaacatgga |
32057965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 29 - 121
Target Start/End: Complemental strand, 26799390 - 26799298
Alignment:
| Q |
29 |
ggtatatggttgaatacaattaggattaatcaaagagagaacttttttgaagcaaatttgcagaattggattgacttaaatatgaacatggag |
121 |
Q |
| |
|
|||||||||||||||||| || | ||| |||||||| ||| ||||||||||||| |||||||| ||||||||||||||||| ||| ||||||| |
|
|
| T |
26799390 |
ggtatatggttgaatacagttggtatttatcaaagaaagagcttttttgaagcatatttgcagcattggattgacttaaatttgagcatggag |
26799298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 149 - 218
Target Start/End: Complemental strand, 32057924 - 32057854
Alignment:
| Q |
149 |
catgccttgtggtcttggagaaac-agttgagtcatgatagtgaagctacaatgcctcttaactcttggaa |
218 |
Q |
| |
|
||||||||||||| ||||||||| |||||||| |||||||| ||||||| ||| |||||||||| ||||| |
|
|
| T |
32057924 |
catgccttgtggttatggagaaacaagttgagttatgatagtaaagctacgatgtctcttaactcatggaa |
32057854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 217
Target Start/End: Complemental strand, 26799280 - 26799236
Alignment:
| Q |
173 |
agttgagtcatgatagtgaagctacaatgcctcttaactcttgga |
217 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||| |||| |
|
|
| T |
26799280 |
agttgagtcatgatagtcaagctatgatgcctcttaactcgtgga |
26799236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University