View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17261_high_16 (Length: 241)
Name: NF17261_high_16
Description: NF17261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17261_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 25 - 226
Target Start/End: Original strand, 12514832 - 12515033
Alignment:
| Q |
25 |
agtcaaatggaatctaaagaaggtgatgagagnnnnnnngaacacaaagtttctatgttaaagctattttcttttgctgactcttatgattatgtcttaa |
124 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12514832 |
agtcaaatggaatccaaagaaggtgatgagagaaaaaaagaacacaaagtttctatgttaaagctattttcttttgctgactcttatgattatgtcttaa |
12514931 |
T |
 |
| Q |
125 |
tgtttattggatctattggagccattgttcatggtgcttctgttcctattttctttattttctttggaaagttgatcaatgttattggcttggcttatct |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12514932 |
tgtttattggatctattggagccattgttcatggtgcttctgttcctattttctttattttctttggaaagttgatcaatgttattggcttggcttatct |
12515031 |
T |
 |
| Q |
225 |
tt |
226 |
Q |
| |
|
|| |
|
|
| T |
12515032 |
tt |
12515033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University