View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17261_low_15 (Length: 249)
Name: NF17261_low_15
Description: NF17261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17261_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 14924944 - 14924725
Alignment:
| Q |
18 |
aacccaaatctgtgacctcctatctacaagagtgaagacaactcgaaaccgtgaacttttgattgcatgcaagataggcttactgcaatttttcatgata |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14924944 |
aacccaaatctgtgatctcctatctacaagagtgaagacaactcgaaaccgtgaacttttgattgcatgcaagataggcttactgcaatttttcatgata |
14924845 |
T |
 |
| Q |
118 |
aaatcattccaataaacatgcaacaacaacatatccagttatttttccaatcatatattcccctattagattttattactattcaacaagtattaattgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14924844 |
aaatcattccaataaacatgcaacaacaacatatccagttatttttccaatcctatattcccctattagattttattactattcaacaagtattaattgt |
14924745 |
T |
 |
| Q |
218 |
tcactcaccgagctgcttca |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
14924744 |
tcactcaccgagctgcttca |
14924725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University