View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17261_low_19 (Length: 227)
Name: NF17261_low_19
Description: NF17261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17261_low_19 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 4569918 - 4570141
Alignment:
| Q |
1 |
aaattgaatgggttactgttaggcttagaaatctatccgttgaattttcttaatgatactatgccagcaatcaaatttaccaacattaaaagtgataata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4569918 |
aaattgaatgggttactgttaggcttagaaatctatccgttgaattttcttactgatactatgccagcaatcaaatttaccaacattaaaagtg---ata |
4570014 |
T |
|
| Q |
101 |
tataatatgttttctattggctaagtctgatttattaaaataagtagaattnnnnnnncataaaatattcaataaagatatttaatcaaatttcgtttta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4570015 |
tataatatgttttctattggctaagtctgatttattaaaataagtagaattaaaaaaacataaaatattcaataaagatatttaatcaaatttcgtttta |
4570114 |
T |
|
| Q |
201 |
agtctcgtttagtgtcgggccagaccc |
227 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
4570115 |
agtctcgtttagtgtcgggccaaaccc |
4570141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 103 - 151
Target Start/End: Original strand, 49059317 - 49059366
Alignment:
| Q |
103 |
taatatgttttctattggctaa-gtctgatttattaaaataagtagaatt |
151 |
Q |
| |
|
||||||||||||||||||| || |||||||| ||| |||||||||||||| |
|
|
| T |
49059317 |
taatatgttttctattggccaaagtctgattcatttaaataagtagaatt |
49059366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University