View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17263_high_5 (Length: 247)
Name: NF17263_high_5
Description: NF17263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17263_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 39439519 - 39439280
Alignment:
| Q |
1 |
atttcttgagagagcatttgcatctatgttgcgtatcaactgctttgtttgttgctgcagctatttgtcctcatactttgcccaaatcactcatcaaacc |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39439519 |
atttcttgagagagcatttgtatctatgttgcgcatcaactgctttgtttgttgctgcagctatttgtcctcatactttgcccaaatcactcatcaaacc |
39439420 |
T |
 |
| Q |
101 |
tgtccaaaactcgttcattctcatcgcatttccgttggttggggtaacaaactaaacaatctctcactcaatttagttctttactgttatgggattattt |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39439419 |
tgtccaaaactcgttcattctcgtcgcatttccgttggttggggtaacaaactaaacaatctctcactcaatttagttctctactgttatgggattattt |
39439320 |
T |
 |
| Q |
201 |
atctctatagcacttacacttctgatggaacacttctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || |||||| |
|
|
| T |
39439319 |
atctctatagcacttacacttctgatcgaagacgtctctg |
39439280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University