View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_high_26 (Length: 387)
Name: NF17264_high_26
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 6e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 52390975 - 52391245
Alignment:
| Q |
1 |
ctggcatatccactattaaatgtaagaaaggcgtgtattatatagaaaagaatgttgtagcttgctgataattgacatgatagacacactaccaaattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52390975 |
ctggcatatccactattaaatgtaagaaaggcgtgtattatatagaaaagaatgttgtagcttgctgataattgacatgatagacacactaccaaaaa-a |
52391073 |
T |
 |
| Q |
101 |
nnnnnnngacatgatagatggtataatgccttnnnnnnnnnnggtggtatgctattgaatata--ttgttggtcattaggaatgaaaacaagggaggaga |
198 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| | | |||||||||||||||||||||||||||||||| |
|
|
| T |
52391074 |
aaaatttgacatgatagatggtataatgccttaaaaaaaaa-ggtggtatgctattgaatagaatatattggtcattaggaatgaaaacaagggaggaga |
52391172 |
T |
 |
| Q |
199 |
ataaatataattgttgacagaaagaggtagtagaaaataatcatcatattacaaacatggataattttcttta |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52391173 |
ataaatataattgttgacagaaagaggtagtagaaaataatcatcatattacaaacatggataattttcttta |
52391245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University