View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_high_36 (Length: 313)
Name: NF17264_high_36
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_high_36 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 6010599 - 6010895
Alignment:
| Q |
1 |
gagatgaatgcaaggaaatttcatgatcaaaagctctttgatagaaccagatgggggtgtattagtagatcttatggtgcctgaaaatgaaagagagtcc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6010599 |
gagaagaatgcaaggaaatttcatgatcaaaagctctttgatagaaccagatgggggtgtattagtagatcttatggtgcctgaaaatgaaagagagtcc |
6010698 |
T |
|
| Q |
101 |
aaggtacttgaagctaagtcacttcctaatgtgaaactaacaaaagttgattatgaatgggtgcatgtgattggtgaaggttgggctagtcctttgaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6010699 |
aaggtacttgaagctaagtcacttcctaatgtgaaactaacaaaagttgattatgaatgggtgcatgtaattggtgaaggttgggctagtcctttgaaag |
6010798 |
T |
|
| Q |
201 |
gtttcatgagggaaaatgaatatcttcaaagtttgcattttaattcacttaggttgaatgatggttcttttgttaatatgtcacttcctattgtttt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6010799 |
gtttcatgagggaaaatgaatatcttcaaagtttgcattttaattcacttaggttgaatgatggttcttttgttaatatgtcacttcctattgtttt |
6010895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 236 - 297
Target Start/End: Complemental strand, 46333245 - 46333184
Alignment:
| Q |
236 |
cattttaattcacttaggttgaatgatggttcttttgttaatatgtcacttcctattgtttt |
297 |
Q |
| |
|
||||| ||||||||||| | |||||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
46333245 |
catttcaattcacttagactcaatgatgggtcttttgtgaatatgtctgttcctattgtttt |
46333184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University