View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_high_50 (Length: 262)
Name: NF17264_high_50
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_high_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 24040476 - 24040225
Alignment:
| Q |
1 |
gtcctagaaggaagacctttgtgaatgactgaaagcaattttgagttatgaatgtgagatagactagaannnnnnnnnnnnnnnnaacagtaaatgttag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
24040476 |
gtcctagaaggaagacctttgtgaatgactgaaagcaattttgagttattaatgtgagatagactagaattttttatttatttttaacggtaaatgttag |
24040377 |
T |
 |
| Q |
101 |
taagttaattgttacgttattttttccttgacaaacttgaattttcaggggttatatatcttctgcaatagctcgcaataatggcttgatttctaatttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24040376 |
taagttaattgttacgttattttttccttgacaaacttgaattttcaggggttatatatcttctgcaatagctcgcaataatggcttggtttctaatttg |
24040277 |
T |
 |
| Q |
201 |
tatgattttaaatctgttgctgcaaacactatgcttctttgcttgttttcct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24040276 |
tatgattttaaatctgttgctgcaaacactatgcttctttgcttgttttcct |
24040225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 147 - 250
Target Start/End: Original strand, 24000525 - 24000628
Alignment:
| Q |
147 |
aggggttatatatcttctgcaatagctcgcaataatggcttgatttctaatttgtatgattttaaatctgttgctgcaaacactatgcttctttgcttgt |
246 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| || ||| |||||||||||||||||||| ||||||||||| |||||||| | || ||| |
|
|
| T |
24000525 |
aggggttatgtatcttctgccatagctcgcaataatgggtttggttcaaatttgtatgattttaaatcaattgctgcaaaccgtatgcttcatcgcatgt |
24000624 |
T |
 |
| Q |
247 |
tttc |
250 |
Q |
| |
|
|||| |
|
|
| T |
24000625 |
tttc |
24000628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University