View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_high_53 (Length: 253)
Name: NF17264_high_53
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_high_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 17 - 132
Target Start/End: Original strand, 45006666 - 45006780
Alignment:
| Q |
17 |
ataaattaatgatctagtcgccataatagtcaggtcaccaaattagttgatcacccatcaactggtaaaggagtattctggtcaatttgttccattcaat |
116 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45006666 |
ataaattaatgatctagtcaccataatagtcaggtcaccaaattagttgatcacccatcaactggtaaaggagaattctggtcaatttgttccattcaat |
45006765 |
T |
 |
| Q |
117 |
gtacccccacaatacc |
132 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
45006766 |
gta-ccccacaatacc |
45006780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University