View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_high_55 (Length: 250)
Name: NF17264_high_55
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_high_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 232
Target Start/End: Complemental strand, 6188720 - 6188505
Alignment:
| Q |
17 |
gaagacaattgttgaagttaagaaaaagaaagcataatggaaaatgttgttggatgttttacgaatttgatgtatcagtcgattcaacaggttggaatgg |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
6188720 |
gaagacaatcgttgaagttaagaaaaagaaagtataatggaaaatgttgttggatgttttacgaatttaatgtatcagttgattcaacaggttggaatgg |
6188621 |
T |
 |
| Q |
117 |
aatttgacaagatctttcgtttatttgatctcgtttgagtcgtagtttcgttaaataagttgaataaatgttaaattgggttgaactattgaaaatatgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6188620 |
aatttgacaagatctttcgtttatttgatctcgtttgagtcgtagtttcgttaaataagttgaataaatgttgaattgggttgaactattgaaaatatgt |
6188521 |
T |
 |
| Q |
217 |
atgaaatattcgaact |
232 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6188520 |
atgaaatattcgaact |
6188505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University