View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_high_61 (Length: 237)
Name: NF17264_high_61
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_high_61 |
 | |
|
| [»] scaffold0098 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 77 - 220
Target Start/End: Original strand, 3532898 - 3533041
Alignment:
| Q |
77 |
gattttagggtttcaactccatccttcatgttcgatttcgaccttcatgcatcatcaatttgatttcgcaattccattcctcatctcgtttggatttgcg |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||| || ||| |
|
|
| T |
3532898 |
gattttagggtttcaactccatccttcatgttcgatttcgaccttcatccatcatcaatttgatttcgcaattccactcctcttctcgtttgggttcgcg |
3532997 |
T |
|
| Q |
177 |
atttcgacctccctccgtcacgattctgctgtcgtgtttgttgt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3532998 |
atttcgacctccctccgtcacgattctgccgtcgtgtttgttgt |
3533041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 77 - 220
Target Start/End: Complemental strand, 38418423 - 38418280
Alignment:
| Q |
77 |
gattttagggtttcaactccatccttcatgttcgatttcgaccttcatgcatcatcaatttgatttcgcaattccattcctcatctcgtttggatttgcg |
176 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| ||||| |||||||| ||||||||||||| ||| |
|
|
| T |
38418423 |
gattttagggtttcaactccattcttcatgttcgatttcgaccttcattcatcatcaatttgatttctcaatttcattcctcttctcgtttggattcgcg |
38418324 |
T |
|
| Q |
177 |
atttcgacctccctccgtcacgattctgctgtcgtgtttgttgt |
220 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38418323 |
atttcgacctccctccgtcacgattttgctgtcgtgtttgttgt |
38418280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0098 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: scaffold0098
Description:
Target: scaffold0098; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 74 - 220
Target Start/End: Original strand, 41598 - 41743
Alignment:
| Q |
74 |
tgggattttagggtttcaactccatccttcatgttcgatttcgaccttcatgcatcatcaatttgatttcgcaattccattcctcatctcgtttggattt |
173 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||| ||||||||||||| |||||||| || || |
|
|
| T |
41598 |
tgggattttagggtttcaacttcatccttcatgttcgatttcgaccttcatccatcatcgatttgatttcaaaattccattcctcttctcgttt-gactt |
41696 |
T |
|
| Q |
174 |
gcgatttcgacctccctccgtcacgattctgctgtcgtgtttgttgt |
220 |
Q |
| |
|
|||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
41697 |
gcgattatgacctccctccgtcacgattatgccgtcgtgtttgttgt |
41743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University