View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_high_72 (Length: 212)
Name: NF17264_high_72
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_high_72 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 17 - 194
Target Start/End: Original strand, 5998531 - 5998708
Alignment:
| Q |
17 |
aaggcctaattaatgatttatttcttgaggtgttctgacatgtagtaaatagtatagtatctacttcttaaattcaatggcacactaattttgccgaagc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5998531 |
aaggcctaattaatgatttatttcttgaggtgttttgacatgtagtaaatagtatagtatctacttcttaaattcaatggcacactaattttgccgaagc |
5998630 |
T |
|
| Q |
117 |
tttaaagtgtagcttttgtcaaaatcacattccaacaccgtgattctactaaactcacctcaaatccaaacatgtact |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5998631 |
tttaaagtgtagcttttgtcaaaatcacattccaacaccgtgattctactaaactcacctcaaatccaaacatgtact |
5998708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 102 - 145
Target Start/End: Complemental strand, 36862204 - 36862161
Alignment:
| Q |
102 |
taattttgccgaagctttaaagtgtagcttttgtcaaaatcaca |
145 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
36862204 |
taattttgtcgaagctctaaagtgtagcttttatcaaaatcaca |
36862161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University