View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_low_27 (Length: 378)
Name: NF17264_low_27
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 2e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 204 - 356
Target Start/End: Complemental strand, 52000242 - 52000090
Alignment:
| Q |
204 |
tcactattatcattgatgtgttgttgcatttgagggatgctataaatgacactgagtgggcttggattcaaaacaacattctcattcaccatctcacttt |
303 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52000242 |
tcactattataattgatgtgttgttgcatttgagggatgctataaatgacactgagtgggcttggattcaaaacaacattctcattcaccatctcacttt |
52000143 |
T |
 |
| Q |
304 |
tcaacgtgttaattttgagattacaagcatctatctttgcatttataacagca |
356 |
Q |
| |
|
| ||| ||||||||||| |||||||||| | ||||| |||| |||||||||| |
|
|
| T |
52000142 |
taaacatgttaattttgtgattacaagcttgaatcttggcatctataacagca |
52000090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 106 - 205
Target Start/End: Complemental strand, 52000409 - 52000310
Alignment:
| Q |
106 |
tctagtggtattgttgaaaccaagctaaaagcataatttagtcatatgtttaaaactataaagcacatacgaggaatcatgtgtttaaaatccatctttc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52000409 |
tctagtggtattgttgaaaccaagctaaaagcataatttagtcatatgtttaaaactataaagcacatacgaggaatcatgtgtttaaaatccatctttc |
52000310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University