View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_low_50 (Length: 288)
Name: NF17264_low_50
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_low_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 275
Target Start/End: Original strand, 39062902 - 39063161
Alignment:
| Q |
19 |
aaaccttatacattttgctaatctgaaatgaaaccatacacttttggttaaatattttgaagttcattaagcgataaattcagaatccactaccacgagt |
118 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39062902 |
aaaccttaaacattttgctaatcggaaatgaaaccatacacttttggttaaatattttgaagttcattaagcgataaattcagaatccactaccacgagt |
39063001 |
T |
 |
| Q |
119 |
tcattgtgtttgcctc---atcaactcaatatgctattgtaatcatcttattgttaccatccttataaactactaactttgaaaatcccccttttcttaa |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39063002 |
tcattgtgtttgcctcgtcatcaactcaatatgctattgtaatcatcttattgttaccatccttgtaaactactaactttgaaaatcccccttttcttaa |
39063101 |
T |
 |
| Q |
216 |
agcagacatctaatccaatgatatgcctacatcattagaggattttctttcatttgatat |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
39063102 |
agcagacatctaatccaatgatatgcctacatcactagaggattttctttcctttgatat |
39063161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University