View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_low_51 (Length: 288)
Name: NF17264_low_51
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_low_51 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 13 - 288
Target Start/End: Complemental strand, 42142327 - 42142052
Alignment:
| Q |
13 |
gttgaaactacgtatctaataagaaagtttagatgttatgagtcaacagcatcacaccaaaactttcctatataatggaggtagaaacttggttggttag |
112 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42142327 |
gttgaaactaagtatctaataagaaagtttagatgttatgagtcaacagcatcacaccaaaactttcctatataatggaggtagaaacttggttggttgg |
42142228 |
T |
|
| Q |
113 |
ccacatacttttcatggcaagttcttaatccatgaaagattgaaaggcatgaatgttattctcacatatccttttaattcaaccattgtgatttgttata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42142227 |
ccacatacttttcatggcaagttcttaatccatgaaagattgaaaggcatgaatgttattctcacatatccttttaattcaaccattgtgatttgttata |
42142128 |
T |
|
| Q |
213 |
agaacatgtcaagaacatgaataaaattggcttggcattgtaagtaactgaacatctatgaaattaaaatgataga |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42142127 |
agaacatgtcaagaacatgaataaaattggcttggcattgtaagtaactgaacatttatgaaattaaaatgataga |
42142052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University