View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_low_56 (Length: 254)
Name: NF17264_low_56
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_low_56 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 254
Target Start/End: Original strand, 23030859 - 23031094
Alignment:
| Q |
18 |
atgaacctaaaatagaattgtggaaactaaaaatacaattaaaccnnnnnnnnacttgttatatttttcttttgcaatcactcaattattttatattact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23030859 |
atgaacctaaaatagaattgtggaaactaaaaatacaattaaactttttttttacttgttatatttttcttttgcaatcactcaattattttatattact |
23030958 |
T |
 |
| Q |
118 |
ttctaccnnnnnnnn-ttatattataacaataaaatttatttttatcaattacttagttatcccctcaaaatcaatcacttaattattttctattacgtt |
216 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23030959 |
ttctaccaaaaaaaaattatattataacaataaaatttatttttatcaattacttagttatcccct--aaatcaatcacttaattattttctattacgtt |
23031056 |
T |
 |
| Q |
217 |
ctaacatnnnnnnnnttgcaacattctattatgttatt |
254 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |
|
|
| T |
23031057 |
ctaacataaaaaaaattgcaacattctattatgttatt |
23031094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University