View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_low_62 (Length: 240)
Name: NF17264_low_62
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_low_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 5 - 224
Target Start/End: Original strand, 52761208 - 52761430
Alignment:
| Q |
5 |
cacttggcgaaggagaattacttgtcggagacactgctggggagtttaccggggcaactgcatcggataacaatgaaattccgagaaacaacattgatac |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
52761208 |
cacttggcgaaggagaattacttgtcggagacactgctggggagtttaccggggcaactgcatcggataacaacgaaattccgagaatcaacattgatac |
52761307 |
T |
|
| Q |
105 |
aatcaaaagagaagcggacctcgacannnnnnngttgg---taactggtagtaattgctaagattttgaatgaaagagttgtaagactatggttgagttg |
201 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52761308 |
aatcaaaagagaagcggacctcgacatttttttgttggtaataactggtagtaattgctaagattttgaatgaaagagttgtaagactatggttgagttg |
52761407 |
T |
|
| Q |
202 |
aaattgaattgtgtggaaatagt |
224 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
52761408 |
aaattgaattgtgtggaaatagt |
52761430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University