View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17264_low_64 (Length: 238)

Name: NF17264_low_64
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17264_low_64
NF17264_low_64
[»] chr7 (2 HSPs)
chr7 (18-185)||(2744916-2745084)
chr7 (210-238)||(2745109-2745137)


Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 185
Target Start/End: Original strand, 2744916 - 2745084
Alignment:
18 gatgcggctacaattgcatttgtgatgtgattgcaaagacatctaaaatcgttattgtatgtttgtgaactcgatttaaaactatatatgattttaatcc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
2744916 gatgcggctacaattgcatttgtgatgtgattgcaaagacatctaaaatcgttattgtatgtttgtgaactcgatttaaaactatatatgattttaattc 2745015  T
118 gtatatgtaacacaatgatatgaa-tttcttatatgatgctgaaaatgaaaaatcttgaacatagaaca 185  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
2745016 gtatatgtaacacaatgatatgaattttcttatatgatgctgaaaatgaaaaatcttgaacatagaaca 2745084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 210 - 238
Target Start/End: Original strand, 2745109 - 2745137
Alignment:
210 gtcaagatcataggttgtataattgttat 238  Q
    |||||||||||||||||||||||||||||    
2745109 gtcaagatcataggttgtataattgttat 2745137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University