View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_low_64 (Length: 238)
Name: NF17264_low_64
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_low_64 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 185
Target Start/End: Original strand, 2744916 - 2745084
Alignment:
| Q |
18 |
gatgcggctacaattgcatttgtgatgtgattgcaaagacatctaaaatcgttattgtatgtttgtgaactcgatttaaaactatatatgattttaatcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2744916 |
gatgcggctacaattgcatttgtgatgtgattgcaaagacatctaaaatcgttattgtatgtttgtgaactcgatttaaaactatatatgattttaattc |
2745015 |
T |
|
| Q |
118 |
gtatatgtaacacaatgatatgaa-tttcttatatgatgctgaaaatgaaaaatcttgaacatagaaca |
185 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2745016 |
gtatatgtaacacaatgatatgaattttcttatatgatgctgaaaatgaaaaatcttgaacatagaaca |
2745084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 210 - 238
Target Start/End: Original strand, 2745109 - 2745137
Alignment:
| Q |
210 |
gtcaagatcataggttgtataattgttat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2745109 |
gtcaagatcataggttgtataattgttat |
2745137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University