View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_low_68 (Length: 234)
Name: NF17264_low_68
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_low_68 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 14 - 234
Target Start/End: Complemental strand, 39932243 - 39932023
Alignment:
| Q |
14 |
attatcattcattcattctcgctaaacaaatcatttcggtttcttatttatttaatcaatgctatcattacattcttcattattatttactcaaattcaa |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39932243 |
attatcattcattcattctctctaaacaaatcatttcggtttcttatttatttaatcaatgctatcattacattcttcattattatttactcaaattcaa |
39932144 |
T |
 |
| Q |
114 |
taatgagtgactcagatcaaaataatgtgttttatttggattggaatattttgttatgttgtgtcgttcagttgaaatatattgttaattataatcagat |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39932143 |
taatgagtgactgagatcaaaataatgtgttttatttggattggaatattttgttatgttgtgtctttcagttgaaatatattgttaattataatcagat |
39932044 |
T |
 |
| Q |
214 |
atatcaggtgttgttgaaact |
234 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
39932043 |
atatcaggtggtgttgaaact |
39932023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University