View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_low_71 (Length: 223)
Name: NF17264_low_71
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_low_71 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 33 - 220
Target Start/End: Original strand, 31928817 - 31929004
Alignment:
| Q |
33 |
aagtaatagaactattattatcttattcttttgttattgctctctcttgtgccctaagtaatagaaacattattattatacatgtcttatgaagctcttt |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31928817 |
aagtaatagaactattattatcttattcttttgttatcgctctctcttgtgccctaagtaatagaaacattatcattatacatgtcttatgaagctcttt |
31928916 |
T |
|
| Q |
133 |
cgatctcttaaattattcagatacttcaacaatgttaaggctctcaatgctaccaacaatgacaccgttggtagtgaatcagaggaca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31928917 |
cgatctcttaaattattcagatacttcagcaatgttaaggctctcaatgctaccaacgatgacaccgttggtagtgaatcagaggaca |
31929004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University