View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_low_72 (Length: 220)
Name: NF17264_low_72
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_low_72 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 34 - 120
Target Start/End: Complemental strand, 38947143 - 38947057
Alignment:
| Q |
34 |
cagaacctgtgaactaggatatattaaaatttattagcaagnnnnnnngaatatattgaatttcttattttattttactatgaggta |
120 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38947143 |
cagaacccgtgaactagaatatattaaaatttattagcaagaaaaaaagaatatattgaatttcttattttattttactatgaggta |
38947057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University