View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17264_low_75 (Length: 215)
Name: NF17264_low_75
Description: NF17264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17264_low_75 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 10 - 196
Target Start/End: Complemental strand, 40690156 - 40689970
Alignment:
| Q |
10 |
gaagcaaaggcaaacttagattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaagacaaaacattccttttctttctaggatgat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40690156 |
gaagcaaaggcaaacttagattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaagacaaaacattccttttctttctaggatgat |
40690057 |
T |
 |
| Q |
110 |
cttcatcaggttccaaagccattggtgtcaaagagagtgtagtgttggctgcagatgttcccaccggcgcgcggtgacgcctcatat |
196 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||| || ||||| |||||||||| |
|
|
| T |
40690056 |
cttcatcaggttccaaagccattgttgtcaaagagagtgtggtgttggctgcagaagttcccaccggtgcacggtggcgcctcatat |
40689970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 16 - 104
Target Start/End: Complemental strand, 34714448 - 34714363
Alignment:
| Q |
16 |
aaggcaaacttagattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaagacaaaacattccttttctttctagg |
104 |
Q |
| |
|
||||||||||| | ||||| ||||| |||| || ||||||||||||||||||||||||||||| | |||||| ||||||||||||| |
|
|
| T |
34714448 |
aaggcaaacttgaactctctttgatcttcttaagctgcaggaaggttgagatccaaatccaaag---agacattcattttctttctagg |
34714363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 79
Target Start/End: Complemental strand, 34710740 - 34710689
Alignment:
| Q |
28 |
gattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaag |
79 |
Q |
| |
|
|||||||| ||||| |||| || ||||||||||||||||||||||||||||| |
|
|
| T |
34710740 |
gattctctttgatcttcttaagctgcaggaaggttgagatccaaatccaaag |
34710689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University