View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17265_high_44 (Length: 322)
Name: NF17265_high_44
Description: NF17265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17265_high_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 266
Target Start/End: Original strand, 22777017 - 22777268
Alignment:
| Q |
15 |
gttttgtcctgtttcannnnnnnctcgtttgaaacttctttttcaattatagatgatgtagttttggatatatttccagtactaatcatctcaagctttt |
114 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22777017 |
gttttgtcctgtttcatttttttctcgtttgaaacttctttttcaattatagatgatgtagttttggatatatttccagtactaatcatctcaagttttt |
22777116 |
T |
|
| Q |
115 |
catctgcggctgcatctaaacgaacgttcgtggaacagccttgcttttcagtggttaataaaagaagattggaagagtaaaggatgtataatattatcat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22777117 |
catctgcggctgcatctaaacgaacgttggtggaacaatctcgtttttcagtggttaataaaagaagattggaagagtaaaggatgtataatattatcat |
22777216 |
T |
|
| Q |
215 |
gattaggatcaaccaagtgatgatacgttgcctgaatgagtacatttggttt |
266 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22777217 |
gattaggatcagccaagtgatgatacgttgcctgaatgagtacatttggttt |
22777268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University