View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17265_high_48 (Length: 299)
Name: NF17265_high_48
Description: NF17265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17265_high_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 11 - 283
Target Start/End: Complemental strand, 28274684 - 28274412
Alignment:
| Q |
11 |
cacagaacaaatatcttcaagttctctaaccacttctgccattttaggacgcggctctggctcatcttcgcaacactttagggccaaatttaaaaacttc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28274684 |
cacagaacaaatatcttcaagttctctaaccacttctgccattttaggacgcggctctggctcatcttcgcaacactttagggccaaatttaaaaacttc |
28274585 |
T |
 |
| Q |
111 |
tctgcatgctcaaatggataagaccccaggcgttcatcaataaatgatgatatctcgctcgattcatatgcaacactaacctgaaaagggtttagagaag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28274584 |
tctgcatgctcaaatggataagaccccatgcgttcatcaataaatgatgatatctcgctcgattcatatgcaacactaacctgaaaagggtttagagaag |
28274485 |
T |
 |
| Q |
211 |
tgttagtgacaagcactctataattaacctgaattgcctaaaatgaagagaagcatgctatcaaggaatctca |
283 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28274484 |
tgttagtgacaagcactcaataattaacctgaattccctaaaatgaagagaagcatgctatcaaggaatctca |
28274412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University