View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17265_high_50 (Length: 293)
Name: NF17265_high_50
Description: NF17265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17265_high_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 273
Target Start/End: Original strand, 7465412 - 7465666
Alignment:
| Q |
19 |
cctgtgcagtgttgaatgtgagcagaatatgggaatcaagggcggactcagccaaattatggcacgtgcatccannnnnnncagaggtgtttttcaaagt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7465412 |
cctgtgcagtgttgaatgtgagcagaatatgggaatcaagggcggactcaggcaaattatggcacgtgcatccatttttttcagaggtgtttttcaaagt |
7465511 |
T |
 |
| Q |
119 |
ctgtcagttgctggataatggagttttggcctcattttgcatggttttatggagtctttggaatagaagaaatacaaaagtattggatggcttgcaaaaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7465512 |
ctgtcagttgctggataatggagttttggcctcatttcgcatggttttatggagtctttggaatagaagaaatacaaaagtattggatggcttgcaaaaa |
7465611 |
T |
 |
| Q |
219 |
gattactctcaggcactggctatggcatataaagtgatgcaatcttggtgtcatg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7465612 |
gattactctcaggcactggctatggcatatcaagtgatgcaatcttggtgtcatg |
7465666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University