View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17265_high_53 (Length: 269)
Name: NF17265_high_53
Description: NF17265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17265_high_53 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 32427271 - 32427531
Alignment:
| Q |
1 |
tgttgtagcatctcttacatccgttcatttagatggcacgaactatgaaaaacctttagagtttgatccatggagatgggaggtaagtaattaaacatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32427271 |
tgttgtagcatctcttacatccgttcatttagatggcacgaactatgaaaaacctttagagtttgatccatggagatgggaggtaagtaattaaacatca |
32427370 |
T |
|
| Q |
101 |
aaatctctctactttatagcttatacttgtttttgaagtgaagttgatacatctaatattgatattacggacaaacacaaccgatgtggtcgcaatgtca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32427371 |
aaatctctctactttatagcttatacttgtttttgaagtgaagttgatacatctaatattgatattacggacaaacacgaccgatgtggtcgcaatgtca |
32427470 |
T |
|
| Q |
201 |
ttagggatatatcgatggaactaatacaacgtggcc----gtaataactcaactatatatt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32427471 |
ttagggatatatcgatggaactaatacaacgtggccgtaagtaataactcaactatatatt |
32427531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 41 - 86
Target Start/End: Complemental strand, 8157759 - 8157714
Alignment:
| Q |
41 |
aactatgaaaaacctttagagtttgatccatggagatgggaggtaa |
86 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
8157759 |
aactatgaaaacccttataagtttgatccatggagatgggaggtaa |
8157714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University