View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17265_high_57 (Length: 262)
Name: NF17265_high_57
Description: NF17265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17265_high_57 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 78 - 247
Target Start/End: Complemental strand, 39975854 - 39975688
Alignment:
| Q |
78 |
gtcaccctcttttgcatgcatgagcatgatggagtaattgatacacgggaggttgcaattggatttcgtgcgtgtatatatacatcacatcttctatgat |
177 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39975854 |
gtcaccctcttttgcatgcatgagcatg---gagtaattgatacacgggaggttgcaattggatttcgtgcgtgtatatatacatcacatcttctatgat |
39975758 |
T |
|
| Q |
178 |
tagtgtttgattaactaagtagatttttcttacaaaatcacaaagtggccattttatgtaggtaaaataa |
247 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39975757 |
taatgtttgattaactaagtagatttttcttacaaaatcacaaagtgaccattttatgtaggtaaaataa |
39975688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 39975931 - 39975880
Alignment:
| Q |
1 |
agcaagtgaaataaagtacgaaacgaaaactctgggatccacacatattgtg |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39975931 |
agcaagtgaaataaagtacgaaacgaaaactttgggatccacacatattgtg |
39975880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University