View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17265_high_58 (Length: 260)
Name: NF17265_high_58
Description: NF17265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17265_high_58 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 2 - 241
Target Start/End: Original strand, 26303190 - 26303429
Alignment:
| Q |
2 |
caaatgaatcatcaaagtatagcatccatcgtcctgctgacactgtggcagtagcagtcatgccacacatgcatggatcatattgcttgagtgaagtgga |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26303190 |
caaatgaatcatcaaagtatagcatccatcgtcttgctgacactgtggcagtagcagtcatgccacacatgcatggatcatattgcttgagtgaagtgga |
26303289 |
T |
|
| Q |
102 |
gcagccaaaatatattgttcatcacaattattattttagtcaacatttcttattgaactttactgttggaaataatcatagatttctagtatacatgagt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26303290 |
gcagccaaaatatattgttcatcacaattattattttagtgaacatttcttattgaactttactgttggaaataatcatagatttctagtatacatgagt |
26303389 |
T |
|
| Q |
202 |
ggaacattataaagcactaagattatgaaaatatttagct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26303390 |
ggaacattataaagcactaagattatgaaaatatttagct |
26303429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University