View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17265_high_77 (Length: 224)
Name: NF17265_high_77
Description: NF17265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17265_high_77 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 32032592 - 32032805
Alignment:
| Q |
1 |
ctttttatctgtctcagttcatgttactgatttcagaccgttaggctcgaaaaagctttattacttgctggttggttcagagagttgttg-ttagtggat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32032592 |
ctttttatctgtctcagttcatgttactgatttcagaccgttaggctcgaaaaagctttattacttgctggttggttcagagagttgttggttagtggat |
32032691 |
T |
|
| Q |
100 |
cttgattccttattggtggtcgatccatacaccagttatgaaccctaattattctttagagatgttcatttttcatcttttttgtatactggtttctcgc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32032692 |
cttgattccttattggtggtcgatccatacaccagttatgaaccctaattattctttagagatgttcatttttcatcttttttgtatcctggtttctcgc |
32032791 |
T |
|
| Q |
200 |
ccgtacacaggttc |
213 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
32032792 |
ccgtacacgggttc |
32032805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 205
Target Start/End: Original strand, 10623607 - 10623672
Alignment:
| Q |
140 |
aaccctaattattctttagagatgttcatttttcatcttttttgtatactggtttctcgcccgtac |
205 |
Q |
| |
|
|||| ||||| ||||||| | ||||||||||||||| ||||||||| |||||||| |||||||| |
|
|
| T |
10623607 |
aaccttaattgttctttacatatgttcatttttcatattttttgtaatctggtttcgtgcccgtac |
10623672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University