View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17265_low_38 (Length: 391)
Name: NF17265_low_38
Description: NF17265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17265_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 18 - 386
Target Start/End: Original strand, 17570443 - 17570804
Alignment:
| Q |
18 |
ggagcgagaaacttaacggcaatggcgttttgcataagtccttctttgcggttaaggagaaagaagatttgttggagaagaagagaagcttcatcgaacg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17570443 |
ggagcgagaaacttaacggcaatggcgttttgcataagtccttctttgcggttaaggagaaagaagatttgttggagaagaagagaagtttcatcgaacg |
17570542 |
T |
 |
| Q |
118 |
tgattcggttgcgttcgatgaaagtgtatgcgaaagcaggtggtgcaggaagtgagagctgtgttgttgctaaagaggattatgctgatgaggaggattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17570543 |
tgattcggttgcgttcgatgaaagtgaatgcgaaagcaggtggtgcaggaagtgagagttgcgttgttgctaaagaggattatgctgatgaggaggattt |
17570642 |
T |
 |
| Q |
218 |
tgttaaagctggtggttctgaacttgtttttgttcaaatgcagcagaaaaagtctatggacttgcaatctaagcttgcggataaggtttgtttcttttat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17570643 |
tgttaaagctggtggttctgaacttgtttttgttcaaatgcagcagaaaaagtctatggacttgcaatctaagcttgcggataaggtttgtttcttttat |
17570742 |
T |
 |
| Q |
318 |
tctgattcttattgtaattgttgttgactatatatgttgagttacgcactatgaagcacaaacacttct |
386 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
17570743 |
tctgattcttattgtaattgttgttgac----tatgtt---ttacgcactatgaagcacaaacacttct |
17570804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University