View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17265_low_55 (Length: 274)
Name: NF17265_low_55
Description: NF17265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17265_low_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 18538290 - 18538546
Alignment:
| Q |
1 |
tggattaatggatgtttatgacttattatcctcacaataagccaaatggtatgtatgatattattttatttgtcttttatatatattgtgtccaatgatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18538290 |
tggattaatggatgtttatgacttattatcctcacaataagccaaatggtatgtatgatattattttatttgtcttttatatatattttgtccaatgatc |
18538389 |
T |
 |
| Q |
101 |
actataagtaacacacgatcatattcatatttcactacaatatactcttaattgaattaatcaaggatgaaaactaaacatttaatctttgaactcttta |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18538390 |
actataagtaacacacggtcatattcatatttcactacaatatactcttaattgaattaatcaaggatgaaaaccaaacatttaatctttgaactcttta |
18538489 |
T |
 |
| Q |
201 |
tttgtgcactaatgtttatctctgttatagaaattgagcaatctaaagatgggaaac |
257 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
18538490 |
tttgtacactaatgtttatctctgttgtagaaattgagcaatctaaaaatgggaaac |
18538546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University