View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17265_low_62 (Length: 258)
Name: NF17265_low_62
Description: NF17265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17265_low_62 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 18 - 206
Target Start/End: Original strand, 36620850 - 36621038
Alignment:
| Q |
18 |
gatgaagcaagggagtggtggagaatacagtttggcgattaatcatacggaggaagagatgctcgaatggggaatgtctcctgatatgattgctgatcag |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36620850 |
gatggagcaagggagtggtggagaatacagtttggcgattaatcatacggaggaagagatgctcgaatggggaatgtctcctgatatgattgctgatcag |
36620949 |
T |
|
| Q |
118 |
aaatggcgtgcagatgcgcctagaggtgcttggaatgatcaatgtccttggtatcttgatggnnnnnnngatcgttttgatgcatctga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36620950 |
aaatggcgtgcagatgcgcctagaggtgcttggaatgatcaatgtccttggtatcttgatggtttttttgatcgttttgatgcatctga |
36621038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 128
Target Start/End: Complemental strand, 46967976 - 46967876
Alignment:
| Q |
28 |
gggagtggtggagaatacagtttggcgattaatcatacggaggaagagatgctcgaatggggaatgtctcctgatatgattgctgatcagaaatggcgtg |
127 |
Q |
| |
|
|||||||||||||| ||||| ||||| || ||||||| || ||||| |||| || ||||| | |||||||||||| | || |||||||||||||||| |
|
|
| T |
46967976 |
gggagtggtggagagtacagcttggcagttcatcatacagatgaagaactgcttgagtgggggctctctcctgatatggtagccgatcagaaatggcgtg |
46967877 |
T |
|
| Q |
128 |
c |
128 |
Q |
| |
|
| |
|
|
| T |
46967876 |
c |
46967876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University