View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17265_low_69 (Length: 245)
Name: NF17265_low_69
Description: NF17265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17265_low_69 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 13 - 124
Target Start/End: Original strand, 51310592 - 51310703
Alignment:
| Q |
13 |
agatgaagaaggtggagccggaacggtggaggagacggagaccgtgacggagggctcttactattctgtctgatattggttggctgtgtttgaaacgata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310592 |
agatgaagaaggtggagccggaacggtggaggagacggagaccgtgacggagggctcttactattctgtctgatattggttggctgtgtttgaaacgata |
51310691 |
T |
 |
| Q |
113 |
gggacggggacg |
124 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51310692 |
gggacggggacg |
51310703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 175 - 227
Target Start/End: Original strand, 51310748 - 51310800
Alignment:
| Q |
175 |
aggcaacagactccatttccaaagaatgaggaacggttttgtgtgaagaatat |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310748 |
aggcaacagactccatttccaaagaatgaggaacggttttgtgtgaagaatat |
51310800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University