View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17265_low_80 (Length: 225)
Name: NF17265_low_80
Description: NF17265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17265_low_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 4233592 - 4233366
Alignment:
| Q |
1 |
ccggacctgatatcctcctcgtgcattaccttagcgtaagattctctggttggttttctttagctcttcac-------ctccgtaaccaccccgtcctcc |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4233592 |
ccggacctgatatcctcctcgtgcattaccttagcgtaagattctctggttggttttctttagctcttcacgatcctcctccgtaaccaccccgtcctcc |
4233493 |
T |
 |
| Q |
94 |
ctgccatatctttcaaacagcatatcgaaagtgaagaagtgtgccatcgtccaaannnnnnnnnnnnnnnnnnnnnaatttcaattctactaggg-tttt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
4233492 |
ctgccatatctttcaaacagcatatcgaaagtgaagaagtgtgccatcgtccaaatctctcttctcttctcttctcaatttcaattctactagggttttt |
4233393 |
T |
 |
| Q |
193 |
ctttcactttaattcaattgaataaat |
219 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
4233392 |
ctttcactttaattcaattgaataaat |
4233366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 105 - 148
Target Start/End: Original strand, 36514406 - 36514449
Alignment:
| Q |
105 |
ttcaaacagcatatcgaaagtgaagaagtgtgccatcgtccaaa |
148 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36514406 |
ttcaaaccgcatatcgaaagtgaagaagtgtgccatcgtccaaa |
36514449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 207
Target Start/End: Original strand, 36514471 - 36514509
Alignment:
| Q |
170 |
aatttcaattctactaggg-ttttctttcactttaattc |
207 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36514471 |
aatttcaattctactagggtttttctttcactttaattc |
36514509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University