View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17268_high_21 (Length: 211)
Name: NF17268_high_21
Description: NF17268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17268_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 14 - 195
Target Start/End: Original strand, 27887852 - 27888035
Alignment:
| Q |
14 |
aagaaaataggtatgtgagtcttcaacgatcaccaataannnnnnn-gaaggaaatgatcatcaataatgaagttcaacatgtaatttttgtt-gtaaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27887852 |
aagaaaataggtatgtgagtcttcaacgatcaccaataattttttttgaaggaaacgatcatcgataatgaagttcaacatgtaatttttgtttgtaaaa |
27887951 |
T |
 |
| Q |
112 |
agtctgcgaattacgctcctttcaaatgatccaaatactagccaactaaatcacttgaaagcaatgacgaatgttcctcctaaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27887952 |
agtctgcgaattacgctcctttcaaatgatccaaatactagccaactaaatcacttgaaagcaatgacgaatgttcctcctaaa |
27888035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University