View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17268_low_8 (Length: 384)
Name: NF17268_low_8
Description: NF17268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17268_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 1 - 367
Target Start/End: Complemental strand, 34144728 - 34144362
Alignment:
| Q |
1 |
tgttggttgatcagaaaatcaatctcgaggattcaaccggtaagagatgggttataacaatttcagaagttgatggttcttttgcttttaagaaaggatg |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34144728 |
tgttggttgatcagaaaatcaatcttgaggattcaaccggtaagagatgggctataacagtatcagaagttgatggttcttttgcttttaagaaaggatg |
34144629 |
T |
|
| Q |
101 |
gggtgatttctcatcggctcacaagcttgaaattggagatttgcttgtattcaactgcattaacaagtataaatttgatgtcaagatctatgaccagtct |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34144628 |
ggatgatttctcatcggctcacaagcttgaaattggagatttgcttgtattcaactgcattaacaagtataactttgatgtcaagatctatgaccagtct |
34144529 |
T |
|
| Q |
201 |
atgtgtgaaaggattgatttttctgataaaagaaagaggaaaaagagaagtagatgcagcagtggctcacttgatgcaggaggaacaccaaatagcgtag |
300 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34144528 |
atgtgtgaaaggattgatttttctgacaaaagaaagaggaaaaagagaagtagatgcagcagtggctcacttgatgcaggaggaacaccaaatagcgtag |
34144429 |
T |
|
| Q |
301 |
aagttgtttcagaaaatggtaatgtggatagaagcgtcaaatgtccgcgcacatcagaagacacatc |
367 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34144428 |
aagttgtttcagaaaatgttaatgtggatagaagcgtcaaatgtccgcgcacatcagaagacacatc |
34144362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University