View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17269_high_14 (Length: 212)
Name: NF17269_high_14
Description: NF17269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17269_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 29318996 - 29318818
Alignment:
| Q |
20 |
cctaacatatgtgcaggtattgaaactgttcaagattggaatgagaaggtaggtcagaattcacctctcaacactgcttgtaaaccagatctcactgatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29318996 |
cctaacatatgtgcaggtattgaaactgttcaagattggaatgagaaggtaggtcagaattcacctctcaacactgcttgtaaaccagatctcactgatc |
29318897 |
T |
 |
| Q |
120 |
tttctcaatgcgctttgtgtgttgttgctggattagaggttaagcagaagcttgtttcagttagtggcaattcttctca |
198 |
Q |
| |
|
|||||||||||| | ||||||||| ||||||||||||||||||| | |||||||||||| ||||||||||||||||||| |
|
|
| T |
29318896 |
tttctcaatgcgatgtgtgtgttgctgctggattagaggttaaggataagcttgtttcaattagtggcaattcttctca |
29318818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 22 - 186
Target Start/End: Original strand, 717491 - 717655
Alignment:
| Q |
22 |
taacatatgtgcaggtattgaaactgttcaagattggaatgagaaggtaggtcagaattcacctctcaacactgcttgtaaaccagatctcactgatctt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||| || | || |||||||||||||||||||||||| ||||| |
|
|
| T |
717491 |
taacatatgtgcaggtattgaaactgttcatgattggaatgagaaagtgggtcagaattcatctttgaatactgcttgtaaaccagatctcactcatctt |
717590 |
T |
 |
| Q |
122 |
tctcaatgcgctttgtgtgttgttgctggattagaggttaagcagaagcttgtttcagttagtgg |
186 |
Q |
| |
|
|||||||| | | || |||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
717591 |
tctcaatgtgatgcatgcgttgctgctggattacaggttaagcagaagcttgtttcagttagtgg |
717655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 23 - 52
Target Start/End: Original strand, 26942185 - 26942214
Alignment:
| Q |
23 |
aacatatgtgcaggtattgaaactgttcaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26942185 |
aacatatgtgcaggtattgaaactgttcaa |
26942214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University