View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17269_high_7 (Length: 433)

Name: NF17269_high_7
Description: NF17269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17269_high_7
NF17269_high_7
[»] chr5 (1 HSPs)
chr5 (3-69)||(13649370-13649435)


Alignment Details
Target: chr5 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 3 - 69
Target Start/End: Original strand, 13649370 - 13649435
Alignment:
3 gacatcattctttgtaaaatcgaaagatttggtaacacaaaggggataagccaagattcctggtcga 69  Q
    |||| |||||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||||    
13649370 gacaccattctttgtgaaatc-aaagatttggtaacacaaaggggataagccaagattcccggtcga 13649435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University