View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17269_low_15 (Length: 210)
Name: NF17269_low_15
Description: NF17269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17269_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 45 - 195
Target Start/End: Complemental strand, 38955135 - 38954987
Alignment:
| Q |
45 |
ttaaatgaatagagtttagaaatatgataaaacacacaaacttgtagcaacttatctttttatttttnnnnnnnnnnnngtacaacatcaagaaatataa |
144 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
38955135 |
ttaaaagaatagagtttagaaatatgataaaacacacaaacttgtagcaacttatctttttattttt--tttaaaaaaagtacaacatcaagaaatatca |
38955038 |
T |
 |
| Q |
145 |
aggccttattcaaacattaatgacaagtttttgaaaacccctagtagaaaa |
195 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38955037 |
aggccttattgaaacattaatgacaagtttttgaaaacccctactagaaaa |
38954987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University