View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17269_low_15 (Length: 210)

Name: NF17269_low_15
Description: NF17269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17269_low_15
NF17269_low_15
[»] chr5 (1 HSPs)
chr5 (45-195)||(38954987-38955135)


Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 45 - 195
Target Start/End: Complemental strand, 38955135 - 38954987
Alignment:
45 ttaaatgaatagagtttagaaatatgataaaacacacaaacttgtagcaacttatctttttatttttnnnnnnnnnnnngtacaacatcaagaaatataa 144  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||||| |    
38955135 ttaaaagaatagagtttagaaatatgataaaacacacaaacttgtagcaacttatctttttattttt--tttaaaaaaagtacaacatcaagaaatatca 38955038  T
145 aggccttattcaaacattaatgacaagtttttgaaaacccctagtagaaaa 195  Q
    |||||||||| |||||||||||||||||||||||||||||||| |||||||    
38955037 aggccttattgaaacattaatgacaagtttttgaaaacccctactagaaaa 38954987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University