View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17269_low_7 (Length: 433)
Name: NF17269_low_7
Description: NF17269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17269_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 3 - 69
Target Start/End: Original strand, 13649370 - 13649435
Alignment:
| Q |
3 |
gacatcattctttgtaaaatcgaaagatttggtaacacaaaggggataagccaagattcctggtcga |
69 |
Q |
| |
|
|||| |||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13649370 |
gacaccattctttgtgaaatc-aaagatttggtaacacaaaggggataagccaagattcccggtcga |
13649435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University