View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1726_high_19 (Length: 232)
Name: NF1726_high_19
Description: NF1726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1726_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 31267947 - 31268165
Alignment:
| Q |
1 |
tttactcacacacacttattgtgatccttaaactcaattcacttctgtcattgcattcataggatcaagaaacta-cttgtgcactcacatccaagccat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31267947 |
tttactcacacacacttattgtgatccttaaactcaattcacttctgtcattgcattcttaggatcaagaaactaacttgtgcactcacatccaagccat |
31268046 |
T |
 |
| Q |
100 |
gaaacgatgtcataaaagttggagttttgcaaaacagaccccttatgcaataggaaaggaaaaagggttccttgtgtaaaaagtgattgtggagagatct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31268047 |
gaaacgatgtcataaaagttggagttttgcaaaacagaccccttatgcaataggaaaggaaaaaggattccttgtgtaaaaagtgattgtggagagatct |
31268146 |
T |
 |
| Q |
200 |
tgaccattgatagtaatgt |
218 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31268147 |
tgaccattgatagtaatgt |
31268165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University