View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1726_low_16 (Length: 271)
Name: NF1726_low_16
Description: NF1726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1726_low_16 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 143 - 271
Target Start/End: Original strand, 41748604 - 41748732
Alignment:
| Q |
143 |
cattagtagtatgatagtattttaatttgtaatgagagaatttatgtttgttaattaattatcatgaggtattagaagcaacgttgttggctgttgcatt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41748604 |
cattagtagtatgatagtattttaatttgtaatgagagaatttatgtttgttaattaattatcatgaggtattagaagcaacgttgttggctgttgcatt |
41748703 |
T |
|
| Q |
243 |
ccattaatattgagtaagtaactgatact |
271 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41748704 |
ccattaatattgagtaagtaactgatact |
41748732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 41748483 - 41748593
Alignment:
| Q |
1 |
gatttccaagatattggggatttgtttggttcggatcctgttactgctgttttgtttgatgaagaaatgagccaagttttgtaacggtagggaggattaa |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41748483 |
gatttccaggatattggggatttgtttggttcggatcctgttactgctgttttgtttgatgaagaaatgagccaagttttgtaacggtagggaggattaa |
41748582 |
T |
|
| Q |
101 |
gttgtaatcag |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
41748583 |
gttgtaatcag |
41748593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University