View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1726_low_24 (Length: 225)
Name: NF1726_low_24
Description: NF1726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1726_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 90 - 206
Target Start/End: Original strand, 9142648 - 9142764
Alignment:
| Q |
90 |
cacgttggtcttttagtttatcaacttcatccctttagggaccaatttgcatagatgagacattcataaaccatgacaatgcaagaaacatatcacatga |
189 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9142648 |
cacgttggtctcttagtttatcaacttcatccctttagggaccaatttgcatagatgagacattcataaaccatgacaatgcaagaaacatatcacatga |
9142747 |
T |
|
| Q |
190 |
acccaattatgctttta |
206 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9142748 |
acccaattatgctttta |
9142764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University