View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17270_high_5 (Length: 240)
Name: NF17270_high_5
Description: NF17270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17270_high_5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 35329389 - 35329168
Alignment:
| Q |
19 |
ccctggccctgcgcaatatccagttgacgcaaatgtgtaatgtataatcagcatttaaattaaggattaacaccagacttaggacttagatttgtgtgct |
118 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35329389 |
ccctggccctgcccaatatccagttgatgcaaatgtgtaatgtataatcagcatttaaattaaggattaacaccagacttgggacttagatttgtgtgct |
35329290 |
T |
|
| Q |
119 |
tggtagtctatggttaatttgtaatcttaaaccttatggtgcccttttgtagcggaaatgtttatggttttaaatggctcatgnnnnnnngggtgtaaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
35329289 |
tggtagtctatggttaatttgtaatcttaaaccttatggtgctcttttgtagcggaaatatttatggttttagatggctcatgtttttttgggtgtaaat |
35329190 |
T |
|
| Q |
219 |
tgagtaacttccgcgcggaact |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35329189 |
tgagtaacttccgcgcggaact |
35329168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University