View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17271_high_6 (Length: 296)
Name: NF17271_high_6
Description: NF17271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17271_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 17 - 221
Target Start/End: Original strand, 27884792 - 27884996
Alignment:
| Q |
17 |
tcacctgcgaccaagattcatcgcgtatttgagcaattctattgcaaataacacttcttccagaatcttccatttccgttataacactacttctagaatc |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27884792 |
tcacctgcgaccaagattcattgcgtatttgagcaattctattgcaaataacacttcttccagaatcttccatttccgttataacactacttctagaatc |
27884891 |
T |
 |
| Q |
117 |
tttgattttcgttataacagtaacaccccttctcttcaatttcctcttccacgttcactttcagttatggcgagttctcaagactcctcttctaccaaaa |
216 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||| ||||||| |
|
|
| T |
27884892 |
tttgcttttcgttataacagtaacaccccttctcttcaatttcctcttccacgttcactttcggttatggcgagttctcaagattcatcttcaaccaaaa |
27884991 |
T |
 |
| Q |
217 |
cggtg |
221 |
Q |
| |
|
||||| |
|
|
| T |
27884992 |
cggtg |
27884996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University