View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17271_high_7 (Length: 254)

Name: NF17271_high_7
Description: NF17271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17271_high_7
NF17271_high_7
[»] chr7 (2 HSPs)
chr7 (1-110)||(32570616-32570725)
chr7 (162-237)||(32570493-32570568)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 32570725 - 32570616
Alignment:
1 cgtttgtgccagcaagaacggggagacaaagacaacgttatgaagacaaccttcgacttgtttctgggtaagttttacattttcatgacatagattcttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32570725 cgtttgtgccagcaagaacggggagacaaagacaacgttatgaagacaaccttcgacttgtttctgggtaagttttacattttcatgacatagattcttt 32570626  T
101 accttcaaaa 110  Q
    | ||||||||    
32570625 atcttcaaaa 32570616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 162 - 237
Target Start/End: Complemental strand, 32570568 - 32570493
Alignment:
162 ttatgaccatgcattattgtgcttattgatatgattgaattgttttgtgttgttgatgggtttccattgatcttct 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32570568 ttatgaccatgcattattgtgcttattgatatgattgaattgttttgtgttgttgatgggtttccattgatcttct 32570493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University