View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17271_low_14 (Length: 220)
Name: NF17271_low_14
Description: NF17271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17271_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 21 - 206
Target Start/End: Original strand, 26122289 - 26122464
Alignment:
| Q |
21 |
agcacacttgtatcaaaagctcgatcgtcacacactttttggtcatgatgcaattgcaatcttactaacaatttgtaaaagggaaataacacgtgatcct |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
26122289 |
agcacacttgtatcaaaagctcgatcgtcacacactttttggtcatgatgcaattgcaatcttaccaacaatctgtaaaagggaaataacac-------- |
26122380 |
T |
|
| Q |
121 |
tggtgatcgttgtgtaatagtcacattttgaggtttataatccccagttttatcctaaactcaatagcttcatcttcatctatgtt |
206 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26122381 |
--gtgatcgttgtgtaatagtcacattttaaggtttataatccccaaatttatcctaaactcaatagctttatcttcatctatgtt |
26122464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 19 - 114
Target Start/End: Original strand, 26131586 - 26131681
Alignment:
| Q |
19 |
atagcacacttgtatcaaaagctcgatcgtcacacactttttggtcatgatgcaattgcaatcttactaacaatttgtaaaagggaaataacacgt |
114 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||| ||||||| ||||| ||| |||| |
|
|
| T |
26131586 |
atagcacacctgtatcaaaagctcgaccgtcacacactttttggtcataatgcaatttcaatcttactaacaaattgtaaacgggaagtaatacgt |
26131681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 142 - 206
Target Start/End: Original strand, 26131695 - 26131759
Alignment:
| Q |
142 |
cacattttgaggtttataatccccagttttatcctaaactcaatagcttcatcttcatctatgtt |
206 |
Q |
| |
|
||||| || |||||||||||||| | ||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
26131695 |
cacatcttaaggtttataatcccaaattttatctcaaattcaatagcttcatcttcatctatgtt |
26131759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University