View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17271_low_5 (Length: 369)
Name: NF17271_low_5
Description: NF17271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17271_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 20 - 357
Target Start/End: Complemental strand, 24602418 - 24602080
Alignment:
| Q |
20 |
aaagaaacatacaagatcatttatgcaacctttttagtccaccttgctagcctaaagctccaaatttatgacaatatttaatacatgctgatgcatt-ca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
24602418 |
aaagaaacatacaagatcatttatgcaacctttttggtccaccttgctagcctaaagctccaaatttatgacaatatttaatacatgctgatgcatttca |
24602319 |
T |
|
| Q |
119 |
tatgcatagaacggtgaccgtttctgaataannnnnnnaaaataatccaattaaattttttaggttaggttggcaatattatcttctggttaggtttgaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24602318 |
tatgcatagaacggtgaccgtttctgaataatttttttaaaataatccaattaaattttttaggttaggttggcaatattatcttctggttaggtttgaa |
24602219 |
T |
|
| Q |
219 |
tgtcgaatttggttggcatgcctttggttagattaataatttaatactcttctgtttgttttcttgctgcccttcaagtttgtccctttcttgcattagg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24602218 |
tgtcgaatttggttggcatgcctttggttagattaataatttaatactcttctgtttgttttcttgctgcccttcaagtttgtccctttcttgcattagg |
24602119 |
T |
|
| Q |
319 |
ttctttgcgtattacctccatggttttttggttcatatt |
357 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24602118 |
ttctttgcgtatttcctccatggttttttggttcatatt |
24602080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University