View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17271_low_6 (Length: 345)
Name: NF17271_low_6
Description: NF17271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17271_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 31 - 326
Target Start/End: Complemental strand, 45037938 - 45037644
Alignment:
| Q |
31 |
gctgaaatatagcaccaaccatttcccctggtcttgnnnnnnnttctagaacggttgcacctaaacttttttactcacttccataataatttccatcgtt |
130 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45037938 |
gctgaaatatagcaccaaccatttccccttgtcttgaaaaaaattcttgaacggttgcacctaaacttttt-actcacttccataataatttccatcgtt |
45037840 |
T |
 |
| Q |
131 |
attccttacttcattttttatgtttttgcttccattgcacgaatgaatggtcaccaaaaaacagctcagtttaagctgctgaaggtgctgtgacatattg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037839 |
attccttacttcattttttatgtttttgcttccattgcacgaatgaatggtcaccaaaaaacagctcagtttaagctgctgaaggtgctgtgacatattg |
45037740 |
T |
 |
| Q |
231 |
aacacgacctacctcagacaatgcttgtacgaatggctcaatttcaacaccattcgtttgtacttcaccacttccactcaaattcttgttgtaatc |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037739 |
aacacgacctacctcagacaatgcttgtacgaatggctcaatttcaaaaccattcgtttgtacttcaccacttccactcaaattcttgttgtaatc |
45037644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University